2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000254 | bli-4 | K04F10.4 | Caenorhabditis elegans |
| WBGene00008400 | drh-3 | D2005.5 | Caenorhabditis elegans |
| WormBase ID | WBStrain00040878 | CGC Received | 2007-12-01 |
| Genotype | drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Laboratory | CGC |
| Mutagen | UV+TMP | Name | ZT2 |
| Outcrossed | x1 | Remark | Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000254 | bli-4 | K04F10.4 | Caenorhabditis elegans |
| WBGene00008400 | drh-3 | D2005.5 | Caenorhabditis elegans |
