WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00040878 CGC Received  2007-12-01
Genotype  drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Laboratory  CGC
Mutagen  UV+TMP Name  ZT2
Outcrossed  x1 Remark  Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.
Species  Caenorhabditis elegans

3 Alleles

Public Name
q782
e937
fj52

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000254 bli-4 K04F10.4 Caenorhabditis elegans
WBGene00008400 drh-3 D2005.5 Caenorhabditis elegans