WormMine: Gene WBGene00126725

• WormBase Gene ID: WBGene00126725
• Gene Name: Cjp-unc-89
• Sequence Name: CJA07521
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin I-set domain; Immunoglobulin I-set; Immunoglobulin subtype; RCSD region; Immunoglobulin-like fold; Immunoglobulin V-set domain; Immunoglobulin subtype 2; Winged helix-like DNA-binding domain superfamily; RCSD; Immunoglobulin-like domain superfamily; and Homeobox-like domain superfamily. Is an ortholog of C. elegans unc-89. In C. elegans, unc-89 is involved in several processes, including myofibril assembly; nematode pharyngeal gland morphogenesis; and regulation of striated muscle contraction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07521a.1	CJA07521a.1		[unknown]
Transcript:CJA07521b.1	CJA07521b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07521a	CJA07521a		[unknown]
CDS:CJA07521b	CJA07521b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076076
• Remark: Cjp-unc-89, CAAGGCACCAAAAGTTATCGAGCCACTGGAGAACGTGCGAATCCCCGAGAAGCAAGGATT, WBGene00126725
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term