WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00126088 Gene Name  Cjp-trr-1
Sequence Name  ? CJA06884 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Dyggve-Melchior-Clausen syndrome protein; Transcription-associated protein 1; Protein kinase-like domain superfamily; Phosphatidylinositol 3-/4-kinase, catalytic domain; PIK-related kinase, FAT; FAT domain; and Armadillo-type fold. Is an ortholog of C. elegans trr-1. In C. elegans, trr-1 is involved in negative regulation of vulval development and positive regulation of growth rate. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA06884.1 CJA06884.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA06884 CJA06884   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA22014, CAAATGTCTGATGAAGAAAGAGCCAGAGATCATTTTGAAGCCGTTGCTGTGGGATGAGCA, WBGene00177586   Expr1085398 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-trr-1, CTCAATCTCTTCAATTGGCTCTATTGGCTGCCACAACTCATTACTGAAGTTCGTCACAAA, WBGene00126088   Expr1087541 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term