WormMine: Gene WBGene00028342

• WormBase Gene ID: WBGene00028342
• Gene Name: Cbr-lin-3
• Sequence Name: CBG05996
• Organism: Caenorhabditis briggsae
• Automated Description: Expressed in anchor cell; gonad; and pharynx. Is an ortholog of C. elegans lin-3. In C. elegans, lin-3 is involved in several processes, including egg-laying behavior; positive regulation of ovulation; and positive regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05996.1	CBG05996.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05996	CBG05996		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

• Primary Identifier: Expr13021
• Pattern: C. briggsae, C. afra, C. angaria and Oscheius tipulae lin-3 is expressed in the anchor cell. Similar to C. elegans, lin-3 expression was also detected at a lower level in the gonad outside the anchor cell and in the pharynx.

• Primary Identifier: Expr1050434
• Remark: Cbr-lin-3, CCTATACAATGAGTCATATGTGCCCACCAGAAGCATTTACCGTTTTGAAAACTCCCAATG, WBGene00028342
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term