WormMine: Gene WBGene00126443

• WormBase Gene ID: WBGene00126443
• Gene Name: CJA07239
• Sequence Name: CJA07239
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Glycoside hydrolase superfamily. Is an ortholog of C. elegans lys-1 and lys-2. In C. elegans, lys-1 is involved in defense response to Gram-negative bacterium; defense response to Gram-positive bacterium; and innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07239a.1	CJA07239a.1		[unknown]
Transcript:CJA07239b.1	CJA07239b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07239b	CJA07239b		[unknown]
CDS:CJA07239a	CJA07239a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081166
• Remark: Cjp-lys-1, TTCAAACAGCCATCAGTGAAACAGTACGCACAGGTTGAGTCGCTGTGCAATCTCGTTGTT, WBGene00126443
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term