WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00062082 Gene Name  Cre-kel-8
Sequence Name  ? CRE18783 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Kelch-type beta propeller; Kelch motif; Kelch repeat type 1; Kelch-like protein 8; BTB/POZ domain; BTB-kelch protein; BTB/Kelch-associated; BTB And C-terminal Kelch; and SKP1/BTB/POZ domain superfamily. Is an ortholog of C. elegans kel-8. In C. elegans, kel-8 is involved in protein ubiquitination and ubiquitin-dependent protein catabolic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE18783.1 CRE18783.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE18783 CRE18783   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-kel-8, TCAGATGAATGGAGCACAGCAGCTGATATGAAGGTTCAAAGAGGAGGAGTAGGAGTGGCC, WBGene00062082   Expr1108015 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term