WormMine: Gene WBGene00061790

• WormBase Gene ID: WBGene00061790
• Gene Name: Cre-ckb-2
• Sequence Name: CRE20372
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Protein kinase-like domain superfamily and Choline/ethanolamine kinase. Is an ortholog of C. elegans ckb-2. In C. elegans, ckb-2 is involved in CDP-choline pathway and IRE1-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20372.1	CRE20372.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20372	CRE20372		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109262
• Remark: Cre-ckb-2, ATTCGAAAACGGCGTGGATCTAGATGTTCAAGCAAGGGATAGACTGGCAGTTTATTTCCA, WBGene00061790
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term