WormMine: Gene WBGene00129079

• WormBase Gene ID: WBGene00129079
• Gene Name: Cjp-cng-3.2
• Sequence Name: CJA09875
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Cyclic nucleotide-binding domain; RmlC-like jelly roll fold; and Cyclic nucleotide-binding-like. Is an ortholog of C. elegans cng-3. In C. elegans, cng-3 is involved in positive regulation of growth rate and response to heat.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09875a.1	CJA09875a.1		[unknown]
Transcript:CJA09875b.1	CJA09875b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09875a	CJA09875a		[unknown]
CDS:CJA09875b	CJA09875b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078392
• Remark: Cjp-cng-3, TTGGAGCCTCATTATTTCTGCCCTGGAGACGTTGTTATTGAAAAGGGACAACTTTGTAGT, WBGene00129079
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term