WormMine: Gene WBGene00128812

• WormBase Gene ID: WBGene00128812
• Gene Name: CJA09607
• Sequence Name: CJA09607
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Testis-expressed protein 10/pre-rRNA-processing protein Ipi1; Rix1 complex component involved in 60S ribosome maturation; Armadillo-type fold; and Pre-rRNA-processing protein Ipi1, N-terminal. Is an ortholog of C. elegans Y48A6C.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09607a.1	CJA09607a.1		[unknown]
Transcript:CJA09607b.1	CJA09607b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09607a	CJA09607a		[unknown]
CDS:CJA09607b	CJA09607b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086822
• Remark: CJA09607, TCAAAATCTCAAGTTGTATCGCCATTTGAGCTCCCTGAAGCTCTGCTCAATCTTTCCAAC, WBGene00128812
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term