WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060584 Gene Name  CRE03962
Sequence Name  ? CRE03962 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Ribosomal proteins 50S-L15, 50S-L18e, 60S-L27A; Ribosomal protein L18e/L15P; and Ribosomal L18e/L15P superfamily. Is an ortholog of C. elegans Y37E3.8. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE03962.1 CRE03962.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE03962 CRE03962   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE03962, TCCACTTATCGTCAAGGCCCGATTCTTCTCCCACGAAGCTGAGCAAAAGATCAAGAAGGC, WBGene00060584   Expr1107337 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term