WormMine: Gene WBGene00080166

• WormBase Gene ID: WBGene00080166
• Gene Name: Cre-sqv-1.2
• Sequence Name: CRE30416
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: GDP-mannose 4,6 dehydratase; NAD(P)-binding domain superfamily; and NAD(P)-binding domain. Is an ortholog of C. elegans sqv-1. In C. elegans, sqv-1 is involved in several processes, including egg-laying behavior; pharynx development; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30416.1	CRE30416.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30416	CRE30416		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095402
• Remark: Cre-sqv-1, GTATTGATGAAGGATGGATTATTGAAGACAATTGAGTACTTCCGAGCGGAAATTGATCGG, WBGene00072414
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term