WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128256 Gene Name  Cjp-npa-1
Sequence Name  ? CJA09052 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Polyprotein allergen, nematode; DVA-1 superfamily; and Nematode polyprotein allergen ABA-1. Is an ortholog of C. elegans npa-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09052.1 CJA09052.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09052 CJA09052   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-npa-1, TTTGCTATCGTCTGTGGGGAATTACTGATGTAGCCAGAAGACGGCGCGTTCCAAAAGAGT, WBGene00128256   Expr1088430 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA25997, CTGCAAACACATTTACGCATCAAGCCGTTCTCAACGCGCCCTTATCGCCCAGGAGGTGGC, WBGene00181569   Expr1077208 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA21847, AGGACACCGAGATCCCATCAAAAGTAAAAGAGTTCTTTGTTAAACTCCCAGCCGATCAAC, WBGene00177419   Expr1076041 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term