WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128190 Gene Name  Cjp-wdr-23
Sequence Name  ? CJA08987 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans wdr-23. In C. elegans, wdr-23 is involved in several processes, including determination of adult lifespan; negative regulation of cellular response to manganese ion; and negative regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA08987.2 CJA08987.2   [unknown]
Transcript:CJA08987.1 CJA08987.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA08987 CJA08987   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA27743, ACGCGGAAATCAAAGTACACGTCACGATACTTTCAGTGCAATGAGCTAAAGGCCGACGCG, WBGene00183316   Expr1081054 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-wdr-23, AGCACATTACGGCTCCGTACGATCACGCGAAGCACGGCGACGAGGACTCTTGCGATGAGC, WBGene00128190   Expr1085800 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term