WormMine: Gene WBGene00060953

• WormBase Gene ID: WBGene00060953
• Gene Name: CRE20788
• Sequence Name: CRE20788
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: N-terminal domain of CBF1 interacting co-repressor CIR; CBF1-interacting co-repressor CIR, N-terminal domain; and Leukocyte receptor cluster member 1-like. Is an ortholog of C. elegans Y18H1A.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20788.1	CRE20788.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20788	CRE20788		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109567
• Remark: CRE20788, AAAAAGAATGGTATGAAGAGATGCCATTGAGAAGAAACCCTGATGGCCTGACGACTTCGA, WBGene00060953
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term