WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00064889 Gene Name  Cre-zer-1
Sequence Name  ? CRE25638 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Leucine-rich repeat domain superfamily; Zyg eleven-related protein 1; Armadillo-type fold; and Armadillo-like helical. Is an ortholog of C. elegans zer-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE25638.1 CRE25638.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE25638 CRE25638   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-zer-1, GAATCCAATTACAACGCCAGATATTCGGATACTGGCCAATACCGTCCTCAGTAACATCAG, WBGene00064889   Expr1105643 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term