WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025024 Gene Name  Cbr-igeg-1
Sequence Name  ? CBG01840 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Immunoglobulin-like fold; EGF-like domain; and EGF-like domain, extracellular. Is an ortholog of C. elegans igeg-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01840a.1 CBG01840a.1   [unknown]
Transcript:CBG01840b.1 CBG01840b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01840b CBG01840b   [unknown]
CDS:CBG01840a CBG01840a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_downregulated
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG01840, ATTCATTTTCCCGCATACACACTGGAATGTACGAGTGTGGGGCAACGAGGAAAAAAGATG, WBGene00025024   Expr1069137 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term