WormMine: Gene WBGene00062992

• WormBase Gene ID: WBGene00062992
• Gene Name: CRE01062
• Sequence Name: CRE01062
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function (DUF4507) and Protein of unknown function DUF4507. Is an ortholog of C. elegans Y56A3A.31.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01062.1	CRE01062.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01062	CRE01062		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113099
• Remark: CRE01062, TTGCTATTTTCTTTTCCGATGGCATTTGGATGTCCTCGCAACAGCAGAAAGAAAAGGACC, WBGene00062992
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term