WormMine: Gene WBGene00066178

• WormBase Gene ID: WBGene00066178
• Gene Name: CRE20860
• Sequence Name: CRE20860
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: TLR4 regulator and MIR-interacting MSAP and Domain of unknown function DUF3456. Is an ortholog of C. elegans C11H1.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20860.1	CRE20860.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20860	CRE20860		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106058
• Remark: CRE20860, GTTATCGAGGAGTGGTTCCTGAAGAAGTTACGTGTAGATGATCTTTTCAAGCAACTTTGT, WBGene00066178
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term