WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00065418 Gene Name  CRE20397
Sequence Name  ? CRE20397 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Bud22 domain; BUD22; and Bud22/Serum response factor-binding protein 1. Is an ortholog of C. elegans F18C12.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE20397.1 CRE20397.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE20397 CRE20397   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE20397, AAATTGGGGATTCAGATGAGGAGACGGTTGGAGACGAGGCGGCGAAGAAGAGGAGAAGTT, WBGene00065418   Expr1106025 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term