3 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00011260 | cnnm-5 | R13G10.4 | Caenorhabditis elegans |
WBGene00013865 | ZC334.7 | ZC334.7 | Caenorhabditis elegans |
WBGene00164968 | K08H2.10 | K08H2.10 | Caenorhabditis elegans |
WormBase ID | WBStrain00047572 | CGC Received | 2019-11-05 |
Genotype | ZC334.7(gk5207) I; cnnm-5(gk5208) III; K08H2.10(gk5209) X. | Laboratory | CGC |
Mutagen | EMS | Name | VC4127 |
Outcrossed | x0 | Remark | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG. The gk5209 mutation is G->T, flanking sequences AAAAAGGAAGACATTGAGTTTGAGGATACA and AACGTCGAATTCATTCTCGAAGTGTTCGAA. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00011260 | cnnm-5 | R13G10.4 | Caenorhabditis elegans |
WBGene00013865 | ZC334.7 | ZC334.7 | Caenorhabditis elegans |
WBGene00164968 | K08H2.10 | K08H2.10 | Caenorhabditis elegans |