1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00001991 | hot-6 | C13G3.2 | Caenorhabditis elegans |
WormBase ID | WBStrain00047574 | CGC Received | 2019-11-05 |
Genotype | hot-6(gk5215) V. | Laboratory | CGC |
Mutagen | EMS | Name | VC4133 |
Outcrossed | x0 | Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5215 mutation is G->A, flanking sequences CACCAATTGGATAAAAGAAAATATCAGTTT and AGTTGCAAGTTGTCGACGAACTGTTGCATT. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00001991 | hot-6 | C13G3.2 | Caenorhabditis elegans |