2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00009090 | fipr-3 | F23D12.6 | Caenorhabditis elegans |
| WBGene00019576 | lido-5 | K09E3.5 | Caenorhabditis elegans |
| WormBase ID | WBStrain00047580 | CGC Received | 2019-11-05 |
| Genotype | fipr-3(gk5263) K09E3.5(gk5264) X. | Laboratory | CGC |
| Mutagen | EMS | Name | VC4177 |
| Outcrossed | x0 | Remark | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5263 mutation is G->A, flanking sequences TTTTTCGTATTTTCAATTTCCAATGTTTCA and CCTTCTTTGTGTCCTTGCCTTGGTCATGTG. The gk5264 mutation is G->A, flanking sequences ATCTTCTTACCTTTGCTCCTTTCGGAGCTT and ATCTTCCCAGCTGATTTCCCTGGCCATAGA. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00009090 | fipr-3 | F23D12.6 | Caenorhabditis elegans |
| WBGene00019576 | lido-5 | K09E3.5 | Caenorhabditis elegans |
