1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00001676 | gpa-14 | B0207.3 | Caenorhabditis elegans |
WormBase ID | WBStrain00047561 | CGC Received | 2019-11-05 |
Genotype | gpa-14(gk5176) I. | Laboratory | CGC |
Mutagen | EMS | Name | VC4088 |
Outcrossed | x0 | Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00001676 | gpa-14 | B0207.3 | Caenorhabditis elegans |