1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00007757 | C27A7.6 | C27A7.6 | Caenorhabditis elegans |
WormBase ID | WBStrain00047562 | CGC Received | 2019-11-05 |
Genotype | C27A7.6(gk5177) V. | Laboratory | CGC |
Mutagen | EMS | Name | VC4089 |
Outcrossed | x0 | Remark | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5177 mutation is C->T, flanking sequences TGTTATACAATTAAATTTAAAAAATCCTTA and CGAGACATCCACAAAGAGTGTAAACGATTA. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00007757 | C27A7.6 | C27A7.6 | Caenorhabditis elegans |