1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00009316 | abhd-11.1 | F32B4.6 | Caenorhabditis elegans |
WormBase ID | WBStrain00047569 | CGC Received | 2019-11-05 |
Genotype | abhd-11.1(gk5194) I. | Laboratory | CGC |
Mutagen | EMS | Name | VC4116 |
Outcrossed | x0 | Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00009316 | abhd-11.1 | F32B4.6 | Caenorhabditis elegans |