WormMine: Strain WBStrain00047567

• WormBase ID: WBStrain00047567
• CGC Received: 2019-11-05
• Genotype: C01A2.6(gk5192) I; F25B5.3(gk5193) III.
• Laboratory: CGC
• Mutagen: EMS
• Name: VC4114
• Outcrossed: x0
• Remark: Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT.
• Species: Caenorhabditis elegans

2 Alleles

Public Name
gk5192
gk5193

1 Data Sets

• WormBaseAcedbConverter

2 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00017775	F25B5.3	F25B5.3	Caenorhabditis elegans
WBGene00007218	C01A2.6	C01A2.6	Caenorhabditis elegans