1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00013958 | nol-16 | ZK265.6 | Caenorhabditis elegans |
WormBase ID | WBStrain00047583 | CGC Received | 2019-11-05 |
Genotype | nol-16(gk5268) I. | Laboratory | CGC |
Mutagen | EMS | Name | VC4182 |
Outcrossed | x0 | Remark | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5268 mutation is G->A, flanking sequences TGCTCATTGATTCATAATTTTGAATTTTCA and AAAGAGATCATCGACGCGGAGCCAATTGAC. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00013958 | nol-16 | ZK265.6 | Caenorhabditis elegans |