1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00008346 | C56A3.8 | C56A3.8 | Caenorhabditis elegans |
WormBase ID | WBStrain00047588 | CGC Received | 2019-11-05 |
Genotype | C56A3.8(gk5298) V. | Laboratory | CGC |
Mutagen | EMS | Name | VC4212 |
Outcrossed | x0 | Remark | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5298 mutation is G->A, flanking sequences ATAATTTTAAGGAAAAAATTAAATTTTTCA and AAACTTTTCCGTCACGGAATCGCTAGCTCC. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00008346 | C56A3.8 | C56A3.8 | Caenorhabditis elegans |