1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00007346 | frpr-2 | C05E7.4 | Caenorhabditis elegans |
Oops!
http://intermine.wormbase.org/tools/wormmine/service/ is incorrectWormBase ID | WBStrain00047586 | CGC Received | 2019-11-05 |
Genotype | frpr-2(gk5296) X. | Laboratory | CGC |
Mutagen | EMS | Name | VC4210 |
Outcrossed | x0 | Remark | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5296 mutation is G->A, flanking sequences ATAGAGGGGTACGCGGGAGTTGCCAATCTG and TAAGTATACTGAAAACCCTAGTTTTCGAGG. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00007346 | frpr-2 | C05E7.4 | Caenorhabditis elegans |