2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00016413 | C34F11.1 | C34F11.1 | Caenorhabditis elegans |
| WBGene00021014 | pid-4 | W03G9.2 | Caenorhabditis elegans |
| WormBase ID | WBStrain00047581 | CGC Received | 2019-11-05 |
| Genotype | W03G9.2(gk5265) I; C34F11.1(gk5266) II. | Laboratory | CGC |
| Mutagen | EMS | Name | VC4178 |
| Outcrossed | x0 | Remark | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00016413 | C34F11.1 | C34F11.1 | Caenorhabditis elegans |
| WBGene00021014 | pid-4 | W03G9.2 | Caenorhabditis elegans |
