| WormBase ID | WBStrain00047454 | CGC Received | 2019-07-10 |
| Genotype | M03F4.6(ve548[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30[ubc-17(tmIs1243)] X. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | RG3048 |
| Outcrossed | x0 | Remark | tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous lethal. Deletion of 2153 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, arrested GFP+ non-mCherry (ve548 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TTTGACTTGTTTGTACCCGCATCTACATTG ; Right flanking sequence: ATCGGGAGTTTCTGCACACTGAGTTCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
| WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
| WBGene00006712 | ubc-17 | B0403.2 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
