WormMine: Gene WBGene00065703

• WormBase Gene ID: WBGene00065703
• Gene Name: Cre-eel-1
• Sequence Name: CRE29934
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Domain of Unknown Function (DUF908); E3 ubiquitin ligase, domain of unknown function DUF908; E3 ubiquitin ligase, domain of unknown function DUF913; Ubiquitin-associated domain; UBA/TS-N domain; HUWE1/Rev1, ubiquitin binding region; Domain of Unknown Function (DUF913); Ubiquitin binding region; and UBA-like superfamily. Is an ortholog of C. elegans eel-1. In C. elegans, eel-1 is involved in several processes, including asymmetric protein localization involved in cell fate determination; hemidesmosome assembly; and signal transduction in response to DNA damage.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29934.1	CRE29934.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29934	CRE29934		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115207
• Remark: Cre-eel-1, TGCTATCCTGACTCAATTCCCAAAACTTTTGGATTTCGATGTGAAGAGAAAATACTTCCG, WBGene00065703
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term