1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00021972 | glb-31 | Y57G7A.9 | Caenorhabditis elegans |
WormBase ID | WBStrain00047558 | CGC Received | 2019-11-05 |
Genotype | glb-31(gk5173) II. | Laboratory | CGC |
Mutagen | EMS | Name | VC4085 |
Outcrossed | x0 | Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00021972 | glb-31 | Y57G7A.9 | Caenorhabditis elegans |