1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00023508 | srz-38 | C35D6.9 | Caenorhabditis elegans |
WormBase ID | WBStrain00047573 | CGC Received | 2019-11-05 |
Genotype | srz-38(gk5214) IV. | Laboratory | CGC |
Mutagen | EMS | Name | VC4132 |
Outcrossed | x0 | Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5214 mutation is C->T, flanking sequences TTACTGTTTCCAGCAGTCAATCATTTCTAT and AAATGACAAGAAACGTTTTTTTCCTCTGCA. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00023508 | srz-38 | C35D6.9 | Caenorhabditis elegans |