2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00020026 | R12C12.6 | R12C12.6 | Caenorhabditis elegans |
| WBGene00008595 | clec-56 | F08H9.7 | Caenorhabditis elegans |
| WormBase ID | WBStrain00047577 | CGC Received | 2019-11-05 |
| Genotype | R12C12.6(gk5239) II; clec-56(gk5240) V. | Laboratory | CGC |
| Mutagen | EMS | Name | VC4156 |
| Outcrossed | x0 | Remark | Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5239 mutation is A->T, flanking sequences AAATTTTAAAAGACTCGGACAAATGCATCG and CATCGTGTATCTTCGAAGTTAGCCTGAAAA. The gk5240 mutation is G->A, flanking sequences ATGCTGACACCAATCACTGCCCTCTTGGAT and GACCTTCTCCACCAATACTTCTTACTGTTA. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00020026 | R12C12.6 | R12C12.6 | Caenorhabditis elegans |
| WBGene00008595 | clec-56 | F08H9.7 | Caenorhabditis elegans |
