| WormBase ID | WBStrain00047598 | CGC Received | 2019-11-05 |
| Genotype | nifk-1(gk5029[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | VC4237 |
| Outcrossed | x1 | Remark | Homozygous lethal or sterile deletion balanced by qC1. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: CAGATCTCAGACACAATGGTTGCCCAGAAT; Right flanking sequence: CCCGTCCAGCTGCTGTCGAAAAGAAAACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| Species | Caenorhabditis elegans |
