1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001824 | hbl-1 | F13D11.2 | Caenorhabditis elegans |
| WormBase ID | WBStrain00047697 | CGC Received | 2019-11-01 |
| Genotype | wIs51 V; hbl-1(ma354) X. | Laboratory | CGC |
| Made By | WBPerson22864 | Mutagen | CRISPR_Cas9 |
| Name | VT3500 | Outcrossed | x2 |
| Remark | wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001824 | hbl-1 | F13D11.2 | Caenorhabditis elegans |
