WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00047718 CGC Received  2019-06-19
Genotype  meg-1(vr10) X. Laboratory  CGC
Made By  WBPerson4009 Mutagen  EMS
Name  YL139 Outcrossed  x8
Remark  Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306. Species  Caenorhabditis elegans

1 Alleles

Public Name
vr10

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00010492 meg-1 K02B9.1 Caenorhabditis elegans