WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00047626 CGC Received  2019-11-05
Genotype  rig-5(gk5383[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  VC4300
Outcrossed  x0 Remark  Homozygous viable. Deletion of 8834 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGGCTGAATCCACTTGAATTGCTCGGAGC; Right flanking sequence: GTAATAGCGACGATTGAGCAATGAAGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Species  Caenorhabditis elegans

1 Alleles

Public Name
gk5383

1 Data Sets

Name URL
WormBaseAcedbConverter  

4 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004372 rig-5 C36F7.4 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans