WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00047697 CGC Received  2019-11-01
Genotype  wIs51 V; hbl-1(ma354) X. Laboratory  CGC
Made By  WBPerson22864 Mutagen  CRISPR_Cas9
Name  VT3500 Outcrossed  x2
Remark  wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111. Species  Caenorhabditis elegans

1 Alleles

Public Name
ma354

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001824 hbl-1 F13D11.2 Caenorhabditis elegans