WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00068417 Gene Name  Cre-lin-49
Sequence Name  ? CRE16289 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Bromodomain; Zinc finger, FYVE/PHD-type; PHD-finger; Zinc finger, PHD-type; Zinc finger, RING/FYVE/PHD-type; Bromodomain-like superfamily; Enhancer of polycomb-like, N-terminal; Enhancer of polycomb-like; and PHD-zinc-finger like domain. Is an ortholog of C. elegans lin-49. In C. elegans, lin-49 is involved in cell fate specification; maintenance of left/right asymmetry; and positive regulation of gene expression. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE16289.1 CRE16289.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE16289 CRE16289   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-lin-49, GGGTTCATCCGGATAAAGTGGAACTGCTCGATTTGAATAATATCAATCAGAGATCTCCGA, WBGene00068417   Expr1115347 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE14382, AAAAGACGAAAACGGAAGAGAGCTGGACGACGTGTGTAATATCTGTTTGGATGGAGACAC, WBGene00073027   Expr1094316 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term