WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00049408 CGC Received  2020-12-16
Genotype  rpoa-49(ve669[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  RG3169
Outcrossed  x0 Remark  Homozygous larval arrest. Deletion of 1099 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ arrested larvae (ve669 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Left flanking Sequence: ATTGGAGCAGAGAAATGGGCTGAGAAACGT; Right flanking sequence: atattttacttattttttcttaaatctttt. sgRNA #3: GTTCGAATTCGAAGCGAACG; sgRNA #4: CGGAGGTTTCAAGAGAATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Species  Caenorhabditis elegans

2 Alleles

Public Name
sc3
ve669

1 Data Sets

Name URL
WormBaseAcedbConverter  

5 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00005017 sqt-2 C01B12.1 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans
WBGene00017749 rpoa-49 F23F1.9 Caenorhabditis elegans