WormMine: Gene WBGene00067216

• WormBase Gene ID: WBGene00067216
• Gene Name: CRE07681
• Sequence Name: CRE07681
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Arrestin (or S-antigen), N-terminal domain; Immunoglobulin E-set; Arrestin C-terminal-like domain; Arrestin-like, C-terminal; Arrestin-like, N-terminal; and Arrestin (or S-antigen), C-terminal domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07681.1	CRE07681.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07681	CRE07681		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111343
• Remark: CRE07681, CCTTGCCCAAAGGCGTCCCACCAAGTTACAAAAGCCTCTTTGGTAAGACCAAGTACAGAG, WBGene00067216
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term