WormMine: Gene WBGene00033670

• WormBase Gene ID: WBGene00033670
• Gene Name: Cbr-cye-1
• Sequence Name: CBG12774
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Cyclin-like; Cyclin; Cyclin-like superfamily; Cyclin, N-terminal; and Cyclin, N-terminal domain. Is an ortholog of C. elegans cye-1. In C. elegans, cye-1 is involved in several processes, including developmental process involved in reproduction; regulation of mitotic cell cycle; and regulation of protein localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12774b.2	CBG12774b.2		[unknown]
Transcript:CBG12774b.1	CBG12774b.1		[unknown]
Transcript:CBG12774a.1	CBG12774a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12774a	CBG12774a		[unknown]
CDS:CBG12774b	CBG12774b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070049
• Remark: Cbr-cye-1, GGACAGCTGCGTTATTCATTGCTGCTAAATACGAGGAGATTTATCCACCAAAATGTGCCG, WBGene00033670
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term