WormMine: Gene WBGene00082004

• WormBase Gene ID: WBGene00082004
• Gene Name: CRE15968
• Sequence Name: CRE15968
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class z (Srz) and Serpentine type 7TM GPCR chemoreceptor Srz. Is an ortholog of C. elegans F47D2.11; ZC132.9; and ZK218.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15968.1	CRE15968.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15968	CRE15968		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106922
• Remark: CRE15968, TCCACCGGAAAATGTCATTGCAACCCACATAAAATATATCGGAGGCATCAAACTTGCTCT, WBGene00082004
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term