WormMine: Gene WBGene00131760

• WormBase Gene ID: WBGene00131760
• Gene Name: Cjp-sma-10
• Sequence Name: CJA12556
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin I-set domain; Immunoglobulin I-set; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin domain; Leucine-rich repeat; Leucine-rich repeat, typical subtype; Immunoglobulin subtype 2; Leucine rich repeat; Leucine-rich repeat domain superfamily; and Immunoglobulin-like domain superfamily. Is an ortholog of C. elegans sma-10. In C. elegans, sma-10 is involved in several processes, including positive regulation of transforming growth factor beta receptor signaling pathway; regulation of mesodermal cell fate specification; and transforming growth factor beta receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12556.1	CJA12556.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12556	CJA12556		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070706
• Remark: CJA12556, ATAGTGGAGAATACTCGTGCGAATTATGGGTTGAGGATACCATGTTGACGAAGAAAGTGA, WBGene00131760
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term