WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028697 Gene Name  Cbr-ges-1
Sequence Name  ? CBG06418 Organism  Caenorhabditis briggsae
Automated Description  Expressed in intestine. Is an ortholog of C. elegans ges-1. In C. elegans, ges-1 is involved in cellular catabolic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG06418.1 CBG06418.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG06418 CBG06418   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Feature : "ges-1.WGATAR"   Expr11335 Multiple copies of either the individual or the paired Cb-ges-1 WGATAR sites, in either orientation and with either C. elegans or C. briggsae as transformation hosts, produce intense reporter gene expression specifically in the embryonic gut. In both host species, reporter expression was first observed at the 4E cell stage of development,the stage at which endogenous ges-1 expression normally can first be detected. Although these reporter constructs initiate expression atthe correct stage, expression is not maintained much laterthan the L2 larval stage in either species;in contrast, endogenous Ce-ges-1 expression continues toincrease throughout the life of the worm. When only a single copy of either the upstreamWGATAR site, the downstream WGATAR site, or thetandem pair of sites was inserted into the test vector andintroduced into C. elegans, no expression in transformedembryos could be detected, either within the gut or elsewhereand even with prolonged staining for b-galactosidaseactivity  
Cbr-ges-1, AACAATTGATATTCTCAGATGGTCGCCGGTGATTGATGGAGATTATTTACCAAAGAATCC, WBGene00028697   Expr1055141 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term