WormMine: Gene WBGene00132120

• WormBase Gene ID: WBGene00132120
• Gene Name: CJA12916
• Sequence Name: CJA12916
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srx and 7TM GPCR, serpentine receptor class x (Srx). Is an ortholog of C. elegans K01A12.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12916b.1	CJA12916b.1		[unknown]
Transcript:CJA12916a.1	CJA12916a.1		[unknown]
Transcript:CJA12916d.1	CJA12916d.1		[unknown]
Transcript:CJA12916c.1	CJA12916c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12916b	CJA12916b		[unknown]
CDS:CJA12916a	CJA12916a		[unknown]
CDS:CJA12916d	CJA12916d		[unknown]
CDS:CJA12916c	CJA12916c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080022
• Remark: CJA12916, GTGTTGGATTTGGGGAGACAGACGGTGGAACACTGGGTCAAATTTGCTAAAAAGGCTAGT, WBGene00132120
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term