WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034515 Gene Name  CBG13818
Sequence Name  ? CBG13818 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: F-box domain; F-box A protein FB155/FB224; FTH domain; and Domain of unknown function DUF38, Caenorhabditis species. Is an ortholog of C. elegans Y6G8.2; Y20C6A.1; and R10E8.6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13818.1 CBG13818.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13818 CBG13818   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
Virus infection: Santeuil infected at L3 larva stage for 12 hours. Transcripts that showed signicantly decreased expression after Santeuil virus infection to C. briggsae strain JU1264. edgeR, FDR < 0.05. WBPaper00051137:Santeuil-virus_downregulated_JU1264

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13818, GCAAAGTGTCCCGTGACATTCGAAACTTCATCGATGACCCGAAAAATCGTTTTCATTTGA, WBGene00034515   Expr1054816 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term